BBa_J153002 1 BBa_J153002 Ptrc2O 2012-02-03T12:00:00Z 2015-08-31T04:08:32Z Ptrc2O was constructed by PCR using the pTrc99A plasmid as a template (Huang etal 2010). Ptrc2O is a modified version of Ptrc1O (link) that contains two lac operators to allow for stronger repression through DNA looping. It contains the lac O1 operator (proximal to the core promoter) and the ideal/symmetrical lac operator (distal to the core promoter) that allow for LacI repression and subsequent induction by IPTG. Usage It was characterized with a GFP reporter construct (link) carried on the broad-host-range shuttle vector pPMQAK1 (link) to be of similar strength and repressibility as Ptrc1O in E. coli DH5alpha. Characterization in the cyanobacterium Synechocystis sp. PCC 6803 revealed strong fluorescence from the Ptrc2O-driven construct, similar to the Ptrc1O-driven construct. However, as compared to Ptrc1O, it was strongly repressed by LacI, but could on the other hand not be induced by IPTG to its full strength (Huang etal 2010) (link). false false _643_ 0 1292 265 It's complicated false None false Daniel Camsund annotation2170090 1 lac Osym (ideal) range2170090 1 1 24 annotation2170091 1 -35 box range2170091 1 57 62 annotation2170093 1 lac O1 range2170093 1 92 112 annotation2170092 1 -10 box range2170092 1 80 85 BBa_J153002_sequence 1 cgaattgtgagcgctcacaattcgaacggttctggcaaatattctgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z