BBa_J15301 1 BBa_J15301 Pars promoter from Escherichia coli chromosomal ars operon. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Escherichia coli K12. Sequence obtained from X80057 (gi:510824). Regulatory sequence annotation from Cai, J., and DuBow, M.S. 1996. Expression of the Escherichia coli chromosomal ars operon. Canadian Journal of Microbiology 42, 662-671; Diorio, C., Cai, J., Marmor, J., Shinder, R., and DuBow, M.S. 1995. An Escherichia coli chromosomal ars operon homolog is functional in arsenic detoxification and is conserved in Gram negative bacteria. Journal of Bacteriology 177, 2050-2056. This is the promoter region of the Escherichia coli chromosomal ars promoter. It is repressed by ArsR in the absence of arsenate or arsenite (Cai, J., and DuBow, M.S. 1996. Expression of the Escherichia coli chromosomal ars operon. Canadian Journal of Microbiology 42, 662-671; Diorio, C., Cai, J., Marmor, J., Shinder, R., and DuBow, M.S. 1995. An Escherichia coli chromosomal ars operon homolog is functional in arsenic detoxification and is conserved in Gram negative bacteria. Journal of Bacteriology 177, 2050-2056). false false _163_ 0 837 163 Not in stock false No modifications were made to the sequence. There appears to be an unexpected repeat of ACT immediately before the SpeI site. This does not affect the biobrick suffix but means that the suffix is 5 bases downstream of the annotated transcriptional start site rather than 2 as recommended. The reason for this is unclear. false Chris French annotation1938077 1 -10 range1938077 1 111 116 annotation1938074 1 ArsR binding range1938074 1 67 71 annotation1938078 1 +1 range1938078 1 123 123 annotation1938076 1 -35 range1938076 1 88 93 annotation1938075 1 ArsR binding range1938075 1 81 85 BBa_J15301_sequence 1 tcctgattcagacctcctttcaaatgaatagccaactcaaaattcacacctattaccttcctctgcacttacacattcgttaagtcatatatgtttttgacttatccgcttcgaagagagacactac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z