BBa_J15502 1 BBa_J15502 copA promoter 2008-05-15T11:00:00Z 2015-08-31T04:08:32Z Escherichia coli K12 Promoter of the copA copper efflux gene from Escherichia coli K12. This promoter is induced in the presence of copper ions, regulated by the activator protein CueR (CopR). false false _163_ 0 837 163 Not in stock false No special considerations false Chris French annotation1963241 1 CpxR range1963241 1 214 227 annotation1963240 1 -10 range1963240 1 273 278 annotation1963239 1 -35 range1963239 1 248 253 BBa_J15502_sequence 1 tgaaattgggtgtaagcctgatccactgcctgctgtaatttgtttgcatctaacatcttttgttaactcctttttatagatgcgggaggtaattcctcaccccggtgccgattttcaggcatcctgatttaacttagcacccgcaacttaactacaggaaaacaaagagataaatgtctaatcctgatgcaaatcgagccgattttttaatctttacggacttttacccgcctggtttattaatttcttgaccttccccttgctggaaggtttaacctttatcacag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z