BBa_J16100 1 BBa_J16100 SupR Gene 2006-07-23T11:00:00Z 2015-08-31T04:08:33Z Acquired from a DNA sample taken from Clark Kent's coffee mug at the Daily Planet The SupR gene encodes the operate super proteins that give Superman all this special powers. Without this gene, he'd just be plain old Clark Kent. The protein Krypton binds to a section of this coding region (see features map), blocking he polymerase and inhibiting transcription of the gene, effectively leaving Superman powerless. false false _1_ 0 740 1 Not in stock false It had one BB restriction site within its sequence - this was removed false James Brown annotation1890734 1 Krypton Bnding Site - inhibits range1890734 1 20 30 BBa_J16100_sequence 1 atgatgcgttattgcgtagatgcggattcggatcacacagtgagattcgctatcggggatgctaatctatatcgatgccctctctcgatagcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z