BBa_J16102 1 BBa_J16102 HngR - Gene encodes Hunger protein 2006-07-23T11:00:00Z 2015-08-31T04:08:33Z Taken from curious George's DNA Present in all mammals, particularly males, the HngR gene is responsible for the empty stomach feeling and nagging need to satisfy that want. false false _48_ 0 740 1 Not in stock false Very common - can always obtain different sequence if needed false James Brown BBa_J16102_sequence 1 atgatgggttcttaggattcgatggagatggatgcagtagatgagatggctagctagtagctgactgatcgtcgatgctgtagctgactgatcgatgctagctagtagctagctagctagtagctagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z