BBa_J16102 1 BBa_J16102 HngR - Gene encodes Hunger protein 2006-07-23T11:00:00Z 2015-08-31T04:08:33Z Taken from curious George's DNA Present in all mammals, particularly males, the HngR gene is responsible for the empty stomach feeling and nagging need to satisfy that want. false false _48_ 0 740 1 Not in stock false Very common - can always obtain different sequence if needed false James Brown BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1701 1 RBS-1\Strong range1701 1 1 15 annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J16101 1 BBa_J16101 BanAp - Banana-induced Promoter 2006-07-23T11:00:00Z 2015-08-31T04:08:33Z Curious George's very own DNA Taken from no other than Curious George, this promoter is induced by the presence of banana in the metabolism of any mammal. It is very weak however without the presence of the HngR protein. For transcription to reach significant levels both HngR and banana must be present false false _48_ 0 740 1 Not in stock false Monkeys can be dangerous when aggrevated false James Brown BBa_J16104 1 BBa_J16104 HG-BDOM - Hunger generator with built in Banana-Dependant Output 2006-07-23T11:00:00Z 2015-08-31T04:08:33Z See Subparts Couples a standard PoPs input to he Hunger-generating HngR gene and BanAp, a banana-induced promoter. The result is a flow of PoPs out of the device reliamt on both a PoPs input and the presence of Banana. false false _1_ 0 740 1 Not in stock false None false James Brown component1890749 1 BBa_J16102 component1890756 1 BBa_J16101 component1890750 1 BBa_B0010 component1890747 1 BBa_B0030 component1890752 1 BBa_B0012 annotation1890756 1 BBa_J16101 range1890756 1 294 312 annotation1890747 1 BBa_B0030 range1890747 1 1 15 annotation1890752 1 BBa_B0012 range1890752 1 247 287 annotation1890750 1 BBa_B0010 range1890750 1 159 238 annotation1890749 1 BBa_J16102 range1890749 1 22 150 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J16101_sequence 1 atgatgtgtccatggatta BBa_J16104_sequence 1 attaaagaggagaaatactagatgatgggttcttaggattcgatggagatggatgcagtagatgagatggctagctagtagctgactgatcgtcgatgctgtagctgactgatcgatgctagctagtagctagctagctagtagctagcttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagatgatgtgtccatggatta BBa_B0030_sequence 1 attaaagaggagaaa BBa_J16102_sequence 1 atgatgggttcttaggattcgatggagatggatgcagtagatgagatggctagctagtagctgactgatcgtcgatgctgtagctgactgatcgatgctagctagtagctagctagctagtagctagct BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z