BBa_J16105 1 BBa_J16105 HelPp - "Help" Dependant promoter 2006-07-23T11:00:00Z 2015-08-31T04:08:33Z DNA sample - Taken from Clark Kent's Coffee Mug at the Daily Planet Transciptional regulator reliant on screams of someone, somewhere in trouble. false false _1_ 0 740 1 Not in stock false Very, Very sensitive false James Brown BBa_J16105_sequence 1 atgatagacgatgtgcggacaacgtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z