BBa_J16400 1 BBa_J16400 Iron sensitive promoter (test delete later) 2006-07-10T11:00:00Z 2015-08-31T04:08:33Z Sequence obtained from GB accn J00010 This is a promoter that is sensitive to iron (Fe++) concentration (test only) false false _1_ 0 341 67 Not in stock false made a base substitution to remove a EcoRI site false Andrew Hessel annotation1883622 1 binding region range1883622 1 11 16 BBa_J16400_sequence 1 atgtgcgattcgcgagcaaagcttta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z