BBa_J16999 1 BBa_J16999 malE [Maltose-binding Protein] 2006-06-08T11:00:00Z 2015-08-31T04:08:33Z Swedish Centre for Bioprocess technology, Stockholm. Ref: Larson, G. (2004) "Solubility and proteolysis of the Zb-MalE and Zb-MalE31 proteins during overproduction in Escherichia coli." Biotechnology and Bioengineering Volume 90, Issue 2 , Pages 239 - 247 malE encodes the maltose-binding protein, essential for both maltose transport and chemotaxis. It resides in the periplasm and undergoes a conformational change on binding to maltose, allowing it to interact with both the transport machinery and chemoreceptors in the cell's inner membrane. false false _1_ 0 740 1 Not in stock false The addition of biobrick ends to the standard malE gene sequence false James Brown annotation1880622 1 binding site X range1880622 1 1 10 BBa_J16999_sequence 1 aatgatggcgttaccgttaggattgccctaaagcgagtacacaatgatggcgttgatggcgttaccgttaggattgccctaaagcgagtacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z