BBa_J176133 1 miRts BCL2 miRts BCL2 2011-12-10T12:00:00Z 2015-08-31T04:08:35Z Synthesized de novo (IDT DNA) Insert this sequence into the 3' UTR of your gene construct (i.e., after the ORF) to place it under control of the natural microRNA miR-34 in human cells. false false _863_ 0 1144 61 Not in stock false This sequence contains three short repeats. false Karmella Haynes, Francesca Ceroni annotation2166748 1 Bcl2 miR-34 target range2166748 1 21 40 annotation2166747 1 Bcl2 miR-34 target range2166747 1 1 20 annotation2166749 1 Bcl2 miR-34 target range2166749 1 41 60 BBa_J176133_sequence 1 gaatcagctatttactgccagaatcagctatttactgccagaatcagctatttactgcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z