BBa_J176134 1 miRts CCND miRts CCND1 2011-12-10T12:00:00Z 2015-08-31T04:08:35Z De novo DNA synthesis (IDT DNA) TBA false false _863_ 0 1144 61 Not in stock false Contains three short repeats false Karmella Haynes, Francesca Ceroni annotation2166750 1 CCND1 miR-34 target range2166750 1 1 20 annotation2166752 1 CCND1 miR-34 target range2166752 1 41 60 annotation2166751 1 CCND1 miR-34 target range2166751 1 21 40 BBa_J176134_sequence 1 acaatgtcatatactgccatacaatgtcatatactgccatacaatgtcatatactgccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z