BBa_J176174 1 BBa_J176174 OS LacI Operator 2013-06-29T11:00:00Z 2015-08-31T04:08:35Z OS was designed for and used in the experiments described in the following paper: Ceroni et al.: Rational design of modular circuits for gene transcription: A test of the bottom-up approach. Journal of Biological Engineering 2010 4:14. OS is an operator in which LacI can bind to in order regulate transcription through repression. O1 is designed to have a specific level of affinity towards LacI. false false _863_ 0 17967 9 Not in stock false N/A false Michael Rose BBa_J176174_sequence 1 aattgtgagcgctcacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z