BBa_J18910 1 BBa_J18910 RFC 25 vector forward (suffix) 2010-01-25T12:00:00Z 2015-08-31T04:08:36Z designed Primer for backbone linearization of RFC 25 construction vectors. Aligns to the RFC 25 prefix but pointing outward into the backbone rather than insert. Annealing temperature: 68 C (in Phusion polymerase buffer) false false _165_ 0 2175 165 Not in stock false optimized for use with BBa_J18911 (reverse suffix) false Raik Gruenberg BBa_J18910_sequence 1 accggttaatactagtagcggcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z