BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z