BBa_J18914 1 FLAG 1xFlag tag 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis A FLAG (DYKDDDDK) antigen epitope tag used for marking proteins of interest. Proteins carrying this tag can be easily detected using commercial western blotting reagents. See also: [[BBa_J64005]] Hopp et al. (1988) A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. http://www.nature.com/nbt/journal/v6/n10/abs/nbt1088-1204.html false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18914_sequence 1 gattataaagatgatgatgataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z