BBa_J18918 1 TEVsite TEV cleavage site (E. coli) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis TEV cleaves the following AA sequence with high specificity: * Glu-Asn-Leu-Tyr-Phe-Gln↓Gly but: * Glu-Asn-Leu-Tyr-Phe-Gln↓Ser is also reported Note, the part suggested by the Voigt lab, also contains 2 additional 1xGly flanks for increased accessibility. See also: * BBa_I712077 (TEV N-term) * BBa_I712078 (TEV C-term) * BBa_I712016 (myri+TEV site, Slovenia team igem2007) * BBa_J64007 (Dan Widmaier, Voigt lab) References =========== Dougherty et al. (1989): Molecular genetic analysis of a plant virus polyprotein cleavage site: a model. PMID: 2669323 false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18918_sequence 1 gaaaacctgtattttcagggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z