BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z