BBa_J18923 1 ZipE34 E34(I) strong heterodimerizing leucine zipper 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis literature Engineered Leu zipper based on VBP B-ZIP domain that forms strong parallel heterodimers with R34. Interaction with R34: * Kd = 6.1 nM References ============ * Acharya et al. (2002) A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. PMID: 12450375 * Bashor et al (2008) Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. PMID: 18339942 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18923_sequence 1 attaccattcgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtaccgaaattgcggaactggaaaaagaagtgggccgttgcgaaaacattgtgagcaaatacgaaacccgttatggcccgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z