BBa_J18924 1 ZipR34 R34 heterodimerizing leucine zipper 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis literature Engineered Leu zipper based on VBP B-ZIP domain that forms medium-weak parallel heterodimers with variants E34(X). This zipper corresponds to RR34(A) in Acharya et al and R34 in Bashor et al. Bashor et al. used the three different pairs to tune the affinity of their MAPK feedback device. Interaction with E34(X) variants: * E34(I): Kd = 6.1 nM = J18923 * E34(V): Kd = 41 nM * E34(N): Kd = 810 nM == References == * Acharya et al. (2002) A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. PMID: 12450375 * Bashor et al (2008) Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. PMID: 18339942 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18924_sequence 1 ctggaaatccgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcgtaaacgtgtgggccgttgccgtaacattgtgagcaaatacgaaacccgttatggcccgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z