BBa_J18925 1 FKBP12 FKBP12 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z literature The immunophilin protein FKBP12 (FK506-binding protein) is the target of the natural compounds FK506 and rapamycin. The FKBP/rapamycin or FKBP/FK506 complex then binds to several other proteins and suppresses immune reactions. Drug screening and design has turned up a selection of other small molecules that bind with high specificity to FKBP12 itself or to mutants of FKBP12. A second human protein, FRB is among the most prominent binding targets of the FKBP/rapamycin complex (using the "other face" of the rapamycin molecule). Rapamycin can herefore induce the hetero-dimerization of FKBP12 and FRB. == See also == * structure of FRB / FKBP / Rapamycin complex: PDB 1nsg (CRG-internal ID: rg0073) false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18925_sequence 1 ggtgtgcaggtggaaaccattagcccgggtgatggccgtacctttccgaaacgtggccagacctgcgtggtgcattataccggcatgctggaagatggcaaaaaatttgatagcagccgcgatcgtaacaaaccgttcaaattcatgctgggcaaacaggaagtgattcgcggctgggaggaaggcgtggcgcagatgagcgttggccagcgtgcgaaactgaccatcagcccggattatgcgtatggcgcgaccggccatccgggtattattccgccgcatgcgaccctggtgtttgatgtggaactgctgaaactggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z