BBa_J18926 1 FRB FRB(T2098L) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z human mTOR (aa sequence) gene synthesis Modified FKBP12-rapamycin-binding domain (FRB) of human mTOR Kinase (=mammalian Target of Rapamycin, also called FRAP = FKBP12-rapamycin associated protein). In presence of the immunosupressant drug rapamycin, FRB forms a high-affinity complex with FKBP12. There is no detectable FKBP12 - FRB interaction in absence of rapamycin. ===Modification for a non-toxic dimerizer=== Rapamycin arrests growth and proliferation of many cell types (reviewed in Jacinto and Hall, 2003) by inhibiting protein translation. The mutation T2089L (mTor numbering) makes FRB binding to a non-toxic Rapamycin analogue (rapalogue) AP21967 as well as the original Rapamycin. The FRB - FKBP12 heterodimerization can then be triggered by both Rapamycin and the non-toxic rapalogue. This variant of FRB and the synthetic dimerizer AP21967 are the basis of the Argent(tm) heterodimerization kit from Ariad Pharmaceuticals Inc. '''Note:''' Two additional mutations would convert FRB into FRB* which is used for conditional (drug-reversible) degradation of fusion proteins. These two additional mutations are not implemented in this part. ===Protein Parameters:=== * Number of amino acids: 93 * Molecular weight: 11285.9 * Theoretical pI: 6.47 false false _165_ 0 2175 165 It's complicated false * aa translation from human mTOR, * mutation T2089L (verified against pC4-RHE from Ariad) * GeneArt codon optimization for E. coli * gene synthesis false Raik Gruenberg BBa_J18926_sequence 1 atcctgtggcatgaaatgtggcatgaaggcctggaagaagcgagccgtctgtattttggcgaacgtaacgtgaaaggcatgtttgaagtgctggaaccgctgcatgccatgatggaacgtggcccgcagaccctgaaagaaaccagctttaaccaggcgtatggccgtgatctgatggaagcgcaggaatggtgccgtaaatacatgaaaagcggcaacgtgaaagatctgctgcaagcgtgggatctgtattatcatgtgtttcgccgcatcagcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z