BBa_J18927 1 Lov2 phot1-LOV2 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z literature gene synthesis The second LOV domain of Arabidopsis phototropin 1 shows light-induced transient (30s) homo-dimerization between a ground state and an excited monomer (Nakasone et al. 2006). LOV2 is predominantly monomeric at concentrations below 100microM but turns dimeric above. Funnily, the high-conc. dimer state experiences photo-dissociation instead. Either the excitation follows a different course from the dimer starting state or the excitation event itself pushes the complex apart. (CRG-internal ID: rg0090) ===References=== * Nakasone et al. 2006 PMID: 16679373 * Freddolino, Peter L.; Dittrich, Markus; Schulten, Klaus (2006) Dynamic Switching Mechanisms in LOV1 and LOV2 Domains of Plant Phototropins PMID: 16935961 false false _165_ 0 2175 165 It's complicated false The fragment used by Nakasone et al. is 475K - 578G. The core domain 449E - 586R has reportedly lower stability at RT (aggregation). * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18927_sequence 1 gaaagcgtggatgataaagtgcgtcagaaagaaatgcgtaaaggcattgatctggccaccaccctggaacgtatcgaaaaaaacttcgtgattaccgatccgcgtctgccggataatccgattatttttgcgagcgatagctttctggaactgaccgaatatagccgtgaagaaattctgggccgtaactgccgttttctgcaaggcccggaaaccgatctgaccaccgtgaaaaaaattcgcaacgcgattgataaccagaccgaagtgaccgtgcagctgattaactataccaaaagcggcaaaaaattctggaacatctttcatctgcaaccgatgcgtgatcagaaaggcgaagtgcagtattttattggcgtgcagctggatggcagcaaacatgtggagccggtgcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z