BBa_J18930 1 mCerulean mCerulean CFP 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z literature gene synthesis Cerulean GFP is an optimized FRET donor molecule that was rationally designed by Piston and co-workers to eliminate the excited-state heterogeneity of ECFP. In ECFP, a single-exponential fit to the fluorescence lifetime is not feasible due to multiple components, whereas Cerulean exhibits essentially homogeneous excited-state decay kinetics, rendering this protein useful for lifetime imaging... Live cell imaging experiments have demonstrated that Cerulean GFP undergoes highly efficient FRET to yellow acceptor molecules (25, 26). Additionally, Cerulean exhibits more than twice the brightness of ECFP and CyPet, emitting light at fluorescence intensities similar to Citrine (20). ===References=== * Rizzo MA, Springer GH, Granada B, Piston DW. (2004) An improved cyan fluorescent protein variant useful for FRET. PMID: 14990965 false false _165_ 0 2175 165 It's complicated false * amino acid sequence taken from a pAG304GAL-Cerulean-ccdB from LindQuist lab * borders trimmed to match the construct used for PDB 2Q57 (last 9 AA are not resolved in PDB) * structure starts with MSK, this construct starts with MVSK but the M has been skipped for this Biobrick * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18930_sequence 1 gtgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggtggaactggatggtgatgtgaacggccataaatttagcgtgagcggcgaaggcgaaggtgatgcgacctatggcaaactgaccctgaaattcatttgcaccaccggcaaactgccggttccgtggccgaccctggttaccaccctgacctggggcgtgcagtgctttgcgcgttatccggatcatatgaaacagcacgatttctttaaaagcgccatgccggaaggctatgtgcaggaacgcaccatcttttttaaagatgatggcaactataaaacccgtgcggaagtgaaatttgaaggcgataccctggtgaaccgtattgaactgaaaggcatcgatttcaaagaagatggcaacattctgggccataaactggaatataactacatcagcgataacgtgtatatcaccgcggataaacagaaaaacggcatcaaagcgaactttaaaatccgccacaacattgaagatggcagcgtgcagctggccgatcattatcagcagaacaccccgattggtgatggcccggtgctgctgccggataaccattatctgagcacccagagcaaactgagcaaagatccgaacgaaaaacgtgatcacatggtgctgctggaatttgtgaccgcagccggtattaccctgggcatggatgaactgtacaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z