BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_J18925 1 FKBP12 FKBP12 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z literature The immunophilin protein FKBP12 (FK506-binding protein) is the target of the natural compounds FK506 and rapamycin. The FKBP/rapamycin or FKBP/FK506 complex then binds to several other proteins and suppresses immune reactions. Drug screening and design has turned up a selection of other small molecules that bind with high specificity to FKBP12 itself or to mutants of FKBP12. A second human protein, FRB is among the most prominent binding targets of the FKBP/rapamycin complex (using the "other face" of the rapamycin molecule). Rapamycin can herefore induce the hetero-dimerization of FKBP12 and FRB. == See also == * structure of FRB / FKBP / Rapamycin complex: PDB 1nsg (CRG-internal ID: rg0073) false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18912 1 T7start T7 promoter + RBS + START 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression vector Strong T7 promoter and RBS including start codon for protein expression in E. coli or in-vitro. Part is provided in RFC 25 assembly format. false false _165_ 0 2175 165 It's complicated false * sequence is taken from the commonly used pET3a expression vector * deleted XbaI site between prom. and RBS * T7 promoter sequence (1-19) equals the one in BBa_I712074 * Conservative choice of part boundaries and modifications -- the part's size could probably be reduced. false Raik Gruenberg annotation2065586 1 start range2065586 1 81 83 BBa_J18930 1 mCerulean mCerulean CFP 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z literature gene synthesis Cerulean GFP is an optimized FRET donor molecule that was rationally designed by Piston and co-workers to eliminate the excited-state heterogeneity of ECFP. In ECFP, a single-exponential fit to the fluorescence lifetime is not feasible due to multiple components, whereas Cerulean exhibits essentially homogeneous excited-state decay kinetics, rendering this protein useful for lifetime imaging... Live cell imaging experiments have demonstrated that Cerulean GFP undergoes highly efficient FRET to yellow acceptor molecules (25, 26). Additionally, Cerulean exhibits more than twice the brightness of ECFP and CyPet, emitting light at fluorescence intensities similar to Citrine (20). ===References=== * Rizzo MA, Springer GH, Granada B, Piston DW. (2004) An improved cyan fluorescent protein variant useful for FRET. PMID: 14990965 false false _165_ 0 2175 165 It's complicated false * amino acid sequence taken from a pAG304GAL-Cerulean-ccdB from LindQuist lab * borders trimmed to match the construct used for PDB 2Q57 (last 9 AA are not resolved in PDB) * structure starts with MSK, this construct starts with MVSK but the M has been skipped for this Biobrick * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18937 1 BBa_J18937 FKBP ~ mCerulean 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z synthetic P05 expression cassette from Gruenberg et al. 2010 series of interaction reporter proteins. All proteins share the same architecture: * T7Start-domain1-5xGS-domain2-preSCsite-HisTag-T7Stop Only Domains1 and 2 vary and are taken from a list of protein interaction input and output (readout) parts. ===Expression=== Proteins were expressed in E. coli BL21 using T7 Polymerase and were purified by His-tag affinity. ===Reference=== * Gruenberg, Ferrar, van der Sloot, Serrano (2010): Building Blocks for Protein Interaction Devices false false _165_ 0 2175 165 It's complicated false Constructs were assembled according to R.F.C. 25. All parts were codon optimized for E. coli. false Raik Gruenberg component2066485 1 BBa_J18913 component2066465 1 BBa_J18912 component2066483 1 BBa_B0105 component2066470 1 BBa_B0105 component2066476 1 BBa_B0105 component2066468 1 BBa_J18925 component2066474 1 BBa_J18930 component2066481 1 BBa_J18909 component2066473 1 BBa_B0105 component2066477 1 BBa_J18919 component2066479 1 BBa_B0105 component2066471 1 BBa_J18922 component2066467 1 BBa_B0105 annotation2066471 1 BBa_J18922 range2066471 1 417 446 annotation2066465 1 BBa_J18912 range2066465 1 1 83 annotation2066476 1 BBa_B0105 range2066476 1 1167 1172 annotation2066483 1 BBa_B0105 range2066483 1 1221 1226 annotation2066481 1 BBa_J18909 range2066481 1 1203 1220 annotation2066467 1 BBa_B0105 range2066467 1 84 89 annotation2066473 1 BBa_B0105 range2066473 1 447 452 annotation2066470 1 BBa_B0105 range2066470 1 411 416 annotation2066485 1 BBa_J18913 range2066485 1 1227 1361 annotation2066479 1 BBa_B0105 range2066479 1 1197 1202 annotation2066474 1 BBa_J18930 range2066474 1 453 1166 annotation2066477 1 BBa_J18919 range2066477 1 1173 1196 annotation2066468 1 BBa_J18925 range2066468 1 90 410 BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_J18922 1 5xGS 10aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 10 amino acid linker. Translates to [GS]_5. Codon-optimize for E. coli, yeast, mammalian. false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli * experimental distance distributions are described in Neuweiler et al. 2006 papers. false Raik Gruenberg BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_J18922_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_J18937_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatgaccggcggtgtgcaggtggaaaccattagcccgggtgatggccgtacctttccgaaacgtggccagacctgcgtggtgcattataccggcatgctggaagatggcaaaaaatttgatagcagccgcgatcgtaacaaaccgttcaaattcatgctgggcaaacaggaagtgattcgcggctgggaggaaggcgtggcgcagatgagcgttggccagcgtgcgaaactgaccatcagcccggattatgcgtatggcgcgaccggccatccgggtattattccgccgcatgcgaccctggtgtttgatgtggaactgctgaaactggaaaccggcggtagcggcagcggtagcggtagcggcagcaccggcgtgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggtggaactggatggtgatgtgaacggccataaatttagcgtgagcggcgaaggcgaaggtgatgcgacctatggcaaactgaccctgaaattcatttgcaccaccggcaaactgccggttccgtggccgaccctggttaccaccctgacctggggcgtgcagtgctttgcgcgttatccggatcatatgaaacagcacgatttctttaaaagcgccatgccggaaggctatgtgcaggaacgcaccatcttttttaaagatgatggcaactataaaacccgtgcggaagtgaaatttgaaggcgataccctggtgaaccgtattgaactgaaaggcatcgatttcaaagaagatggcaacattctgggccataaactggaatataactacatcagcgataacgtgtatatcaccgcggataaacagaaaaacggcatcaaagcgaactttaaaatccgccacaacattgaagatggcagcgtgcagctggccgatcattatcagcagaacaccccgattggtgatggcccggtgctgctgccggataaccattatctgagcacccagagcaaactgagcaaagatccgaacgaaaaacgtgatcacatggtgctgctggaatttgtgaccgcagccggtattaccctgggcatggatgaactgtacaaaaccggcctggaagtgctgtttcagggcccgaccggccatcatcatcatcatcataccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_B0105_sequence 1 accggc BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18909_sequence 1 catcatcatcatcatcat BBa_J18930_sequence 1 gtgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggtggaactggatggtgatgtgaacggccataaatttagcgtgagcggcgaaggcgaaggtgatgcgacctatggcaaactgaccctgaaattcatttgcaccaccggcaaactgccggttccgtggccgaccctggttaccaccctgacctggggcgtgcagtgctttgcgcgttatccggatcatatgaaacagcacgatttctttaaaagcgccatgccggaaggctatgtgcaggaacgcaccatcttttttaaagatgatggcaactataaaacccgtgcggaagtgaaatttgaaggcgataccctggtgaaccgtattgaactgaaaggcatcgatttcaaagaagatggcaacattctgggccataaactggaatataactacatcagcgataacgtgtatatcaccgcggataaacagaaaaacggcatcaaagcgaactttaaaatccgccacaacattgaagatggcagcgtgcagctggccgatcattatcagcagaacaccccgattggtgatggcccggtgctgctgccggataaccattatctgagcacccagagcaaactgagcaaagatccgaacgaaaaacgtgatcacatggtgctgctggaatttgtgaccgcagccggtattaccctgggcatggatgaactgtacaaa BBa_J18912_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatg BBa_J18925_sequence 1 ggtgtgcaggtggaaaccattagcccgggtgatggccgtacctttccgaaacgtggccagacctgcgtggtgcattataccggcatgctggaagatggcaaaaaatttgatagcagccgcgatcgtaacaaaccgttcaaattcatgctgggcaaacaggaagtgattcgcggctgggaggaaggcgtggcgcagatgagcgttggccagcgtgcgaaactgaccatcagcccggattatgcgtatggcgcgaccggccatccgggtattattccgccgcatgcgaccctggtgtttgatgtggaactgctgaaactggaa BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z