BBa_J18912 1 T7start T7 promoter + RBS + START 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression vector Strong T7 promoter and RBS including start codon for protein expression in E. coli or in-vitro. Part is provided in RFC 25 assembly format. false false _165_ 0 2175 165 It's complicated false * sequence is taken from the commonly used pET3a expression vector * deleted XbaI site between prom. and RBS * T7 promoter sequence (1-19) equals the one in BBa_I712074 * Conservative choice of part boundaries and modifications -- the part's size could probably be reduced. false Raik Gruenberg annotation2065586 1 start range2065586 1 81 83 BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_J18938 1 BBa_J18938 FKBP ~ bla-frag1 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z synthetic P06 expression cassette from Gruenberg et al. 2010 series of interaction reporter proteins. All proteins share the same architecture: * T7Start-domain1-5xGS-domain2-preSCsite-HisTag-T7Stop Only Domains1 and 2 vary and are taken from a list of protein interaction input and output (readout) parts. ===Expression=== Proteins were expressed in E. coli BL21 using T7 Polymerase and were purified by His-tag affinity. ===Reference=== * Gruenberg, Ferrar, van der Sloot, Serrano (2010): Building Blocks for Protein Interaction Devices false false _165_ 0 2175 165 It's complicated false Constructs were assembled according to R.F.C. 25. All parts were codon optimized for E. coli. false Raik Gruenberg component2066504 1 BBa_B0105 component2066501 1 BBa_B0105 component2066502 1 BBa_J18919 component2066487 1 BBa_J18912 component2066493 1 BBa_J18922 component2066510 1 BBa_J18913 component2066489 1 BBa_B0105 component2066492 1 BBa_B0105 component2066495 1 BBa_B0105 component2066490 1 BBa_J18925 component2066508 1 BBa_B0105 component2066499 1 BBa_I757011 component2066506 1 BBa_J18909 annotation2066501 1 BBa_B0105 range2066501 1 996 1001 annotation2066489 1 BBa_B0105 range2066489 1 84 89 annotation2066492 1 BBa_B0105 range2066492 1 411 416 annotation2066502 1 BBa_J18919 range2066502 1 1002 1025 annotation2066510 1 BBa_J18913 range2066510 1 1056 1190 annotation2066504 1 BBa_B0105 range2066504 1 1026 1031 annotation2066508 1 BBa_B0105 range2066508 1 1050 1055 annotation2066493 1 BBa_J18922 range2066493 1 417 446 annotation2066495 1 BBa_B0105 range2066495 1 447 452 annotation2066506 1 BBa_J18909 range2066506 1 1032 1049 annotation2066490 1 BBa_J18925 range2066490 1 90 410 annotation2066487 1 BBa_J18912 range2066487 1 1 83 annotation2066499 1 BBa_I757011 range2066499 1 453 995 BBa_J18925 1 FKBP12 FKBP12 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z literature The immunophilin protein FKBP12 (FK506-binding protein) is the target of the natural compounds FK506 and rapamycin. The FKBP/rapamycin or FKBP/FK506 complex then binds to several other proteins and suppresses immune reactions. Drug screening and design has turned up a selection of other small molecules that bind with high specificity to FKBP12 itself or to mutants of FKBP12. A second human protein, FRB is among the most prominent binding targets of the FKBP/rapamycin complex (using the "other face" of the rapamycin molecule). Rapamycin can herefore induce the hetero-dimerization of FKBP12 and FRB. == See also == * structure of FRB / FKBP / Rapamycin complex: PDB 1nsg (CRG-internal ID: rg0073) false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_I757011 1 BBa_I757011 bla_frag1(aa 26-199) Fusion Part 2007-10-23T11:00:00Z 2015-08-31T04:08:07Z synthetic DNA by GeneArt * first fragment of the split enzyme beta-lactamase * NgoMIV / AgeI protein fusion part * iGEM Team Freiburg 2007 false false _125_ 0 2006 9 It's complicated false between BioBrick 1.0 sites part is flanked 5' by NgoMIV and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions false Freiburg iGEM 2007 team annotation1954441 1 NgoMIV range1954441 1 4 9 annotation1954942 1 bla_frag1 range1954942 1 10 534 annotation1954442 1 AgeI range1954442 1 535 540 BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_J18922 1 5xGS 10aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 10 amino acid linker. Translates to [GS]_5. Codon-optimize for E. coli, yeast, mammalian. false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli * experimental distance distributions are described in Neuweiler et al. 2006 papers. false Raik Gruenberg BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18922_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_B0105_sequence 1 accggc BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_I757011_sequence 1 atggccggccacccggaaaccctggccaaagtgaaagatgcggaagatcagctgggtgcgcgtgtgggctatattgaactggatctgaacagcggcaaaattctggaatcttttcgtccggaagaacgttttccgatgatgagcacctttaaagtgctgctgtgcggtgcggttctgagccgtattgatgcgggccaggaacagctgggccgtcgtattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgggcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggtccgaaagaactgaccgcgtttctgcgtaacatgggcgatcatgtgacccgtctggatcgttgggaaccggaactgaacgaagcgattccgaacgatgaacgtgataccaccaccccggtggccatggcgaccaccctgcgtaaactgctgaccggcgaactgctgggcaccggttaa BBa_J18909_sequence 1 catcatcatcatcatcat BBa_J18938_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatgaccggcggtgtgcaggtggaaaccattagcccgggtgatggccgtacctttccgaaacgtggccagacctgcgtggtgcattataccggcatgctggaagatggcaaaaaatttgatagcagccgcgatcgtaacaaaccgttcaaattcatgctgggcaaacaggaagtgattcgcggctgggaggaaggcgtggcgcagatgagcgttggccagcgtgcgaaactgaccatcagcccggattatgcgtatggcgcgaccggccatccgggtattattccgccgcatgcgaccctggtgtttgatgtggaactgctgaaactggaaaccggcggtagcggcagcggtagcggtagcggcagcaccggcatggccggccacccggaaaccctggccaaagtgaaagatgcggaagatcagctgggtgcgcgtgtgggctatattgaactggatctgaacagcggcaaaattctggaatcttttcgtccggaagaacgttttccgatgatgagcacctttaaagtgctgctgtgcggtgcggttctgagccgtattgatgcgggccaggaacagctgggccgtcgtattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgggcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggtccgaaagaactgaccgcgtttctgcgtaacatgggcgatcatgtgacccgtctggatcgttgggaaccggaactgaacgaagcgattccgaacgatgaacgtgataccaccaccccggtggccatggcgaccaccctgcgtaaactgctgaccggcgaactgctgggcaccggttaaaccggcctggaagtgctgtttcagggcccgaccggccatcatcatcatcatcataccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18912_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatg BBa_J18925_sequence 1 ggtgtgcaggtggaaaccattagcccgggtgatggccgtacctttccgaaacgtggccagacctgcgtggtgcattataccggcatgctggaagatggcaaaaaatttgatagcagccgcgatcgtaacaaaccgttcaaattcatgctgggcaaacaggaagtgattcgcggctgggaggaaggcgtggcgcagatgagcgttggccagcgtgcgaaactgaccatcagcccggattatgcgtatggcgcgaccggccatccgggtattattccgccgcatgcgaccctggtgtttgatgtggaactgctgaaactggaa BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z