BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_J18928 1 GLucFrag1 Gaussia princeps Luciferase fragment 1 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis N-terminal fragment of H. gaussia luciferase for PCA. '''Disulfide bonds:''' * likely, many Cys in sequence ===Purification=== Inouye & Sahara (2008) discuss the purification and in-vitro activity of different Luciferases, including Gaussia. They indicate that Gaussia Luciferase was previously purified from insoluable fractions -- perhaps due to the high Cys content. Goerke et al (2008) Provide optimized in-vitro expression conditions for Gaussia Luciferase based on tuning the strain from which the cell-free lysate is produced. ===References=== http://www.ncbi.nlm.nih.gov/pubmed/17099704 Remy I, Michnick SW. (2006) A highly sensitive protein-protein interaction assay based on Gaussia luciferase. http://nar.oxfordjournals.org/cgi/content/full/27/13/e4#hd1 Maroun M, Aronheim A. (2007) A novel in vivo assay for the analysis of protein-protein interaction. PMID: 10373602 http://www.ncbi.nlm.nih.gov/pubmed/19373229 Tannous BA. (2009) Gaussia luciferase reporter assay for monitoring biological processes in culture and in vivo. http://www.ncbi.nlm.nih.gov/pubmed/18789309 Inouye S, Sahara Y. (2008) Soluble protein expression in E. coli cells using IgG-binding domain of protein A as a solubilizing partner in the cold induced system. http://www.ncbi.nlm.nih.gov/pubmed/18555198 Goerke AR, Loening AM, Gambhir SS, Swartz JR. (2008) Cell-free metabolic engineering promotes high-level production of bioactive Gaussia princeps luciferase. false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_J18943 1 BBa_J18943 ZipE34 ~ GLucFrag1 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z synthetic P11 expression cassette from Gruenberg et al. 2010 series of interaction reporter proteins. All proteins share the same architecture: * T7Start-domain1-5xGS-domain2-preSCsite-HisTag-T7Stop Only Domains1 and 2 vary and are taken from a list of protein interaction input and output (readout) parts. ===Expression=== Proteins were expressed in E. coli BL21 using T7 Polymerase and were purified by His-tag affinity. ===Reference=== * Gruenberg, Ferrar, van der Sloot, Serrano (2010): Building Blocks for Protein Interaction Devices false false _165_ 0 2175 165 It's complicated false Constructs were assembled according to R.F.C. 25. All parts were codon optimized for E. coli. false Raik Gruenberg component2066623 1 BBa_J18913 component2066603 1 BBa_J18912 component2066612 1 BBa_J18928 component2066609 1 BBa_J18922 component2066621 1 BBa_B0105 component2066606 1 BBa_J18923 component2066608 1 BBa_B0105 component2066614 1 BBa_B0105 component2066605 1 BBa_B0105 component2066611 1 BBa_B0105 component2066617 1 BBa_B0105 component2066615 1 BBa_J18919 component2066619 1 BBa_J18909 annotation2066608 1 BBa_B0105 range2066608 1 219 224 annotation2066619 1 BBa_J18909 range2066619 1 573 590 annotation2066606 1 BBa_J18923 range2066606 1 90 218 annotation2066617 1 BBa_B0105 range2066617 1 567 572 annotation2066615 1 BBa_J18919 range2066615 1 543 566 annotation2066621 1 BBa_B0105 range2066621 1 591 596 annotation2066612 1 BBa_J18928 range2066612 1 261 536 annotation2066605 1 BBa_B0105 range2066605 1 84 89 annotation2066609 1 BBa_J18922 range2066609 1 225 254 annotation2066614 1 BBa_B0105 range2066614 1 537 542 annotation2066623 1 BBa_J18913 range2066623 1 597 731 annotation2066611 1 BBa_B0105 range2066611 1 255 260 annotation2066603 1 BBa_J18912 range2066603 1 1 83 BBa_J18922 1 5xGS 10aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 10 amino acid linker. Translates to [GS]_5. Codon-optimize for E. coli, yeast, mammalian. false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli * experimental distance distributions are described in Neuweiler et al. 2006 papers. false Raik Gruenberg BBa_J18912 1 T7start T7 promoter + RBS + START 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression vector Strong T7 promoter and RBS including start codon for protein expression in E. coli or in-vitro. Part is provided in RFC 25 assembly format. false false _165_ 0 2175 165 It's complicated false * sequence is taken from the commonly used pET3a expression vector * deleted XbaI site between prom. and RBS * T7 promoter sequence (1-19) equals the one in BBa_I712074 * Conservative choice of part boundaries and modifications -- the part's size could probably be reduced. false Raik Gruenberg annotation2065586 1 start range2065586 1 81 83 BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18923 1 ZipE34 E34(I) strong heterodimerizing leucine zipper 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis literature Engineered Leu zipper based on VBP B-ZIP domain that forms strong parallel heterodimers with R34. Interaction with R34: * Kd = 6.1 nM References ============ * Acharya et al. (2002) A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. PMID: 12450375 * Bashor et al (2008) Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. PMID: 18339942 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18922_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_B0105_sequence 1 accggc BBa_J18928_sequence 1 aaaccgaccgaaaacaacgaagattttaacattgtggcggtggcgagcaactttgcgaccaccgatctggatgcggatcgtggcaaactgccgggcaaaaaactgccgctggaagtgctgaaagaaatggaagcgaacgcgcgtaaagccggttgcacccgtggctgcctgatttgcctgagccatattaaatgcaccccgaaaatgaaaaaatttatcccgggtcgttgccatacctatgaaggcgataaagaaagcgcgcagggcggcattggc BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18909_sequence 1 catcatcatcatcatcat BBa_J18943_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatgaccggcattaccattcgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtaccgaaattgcggaactggaaaaagaagtgggccgttgcgaaaacattgtgagcaaatacgaaacccgttatggcccgctgaccggcggtagcggcagcggtagcggtagcggcagcaccggcaaaccgaccgaaaacaacgaagattttaacattgtggcggtggcgagcaactttgcgaccaccgatctggatgcggatcgtggcaaactgccgggcaaaaaactgccgctggaagtgctgaaagaaatggaagcgaacgcgcgtaaagccggttgcacccgtggctgcctgatttgcctgagccatattaaatgcaccccgaaaatgaaaaaatttatcccgggtcgttgccatacctatgaaggcgataaagaaagcgcgcagggcggcattggcaccggcctggaagtgctgtttcagggcccgaccggccatcatcatcatcatcataccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18912_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatg BBa_J18923_sequence 1 attaccattcgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtaccgaaattgcggaactggaaaaagaagtgggccgttgcgaaaacattgtgagcaaatacgaaacccgttatggcccgctg BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z