BBa_J18912 1 T7start T7 promoter + RBS + START 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression vector Strong T7 promoter and RBS including start codon for protein expression in E. coli or in-vitro. Part is provided in RFC 25 assembly format. false false _165_ 0 2175 165 It's complicated false * sequence is taken from the commonly used pET3a expression vector * deleted XbaI site between prom. and RBS * T7 promoter sequence (1-19) equals the one in BBa_I712074 * Conservative choice of part boundaries and modifications -- the part's size could probably be reduced. false Raik Gruenberg annotation2065586 1 start range2065586 1 81 83 BBa_J18929 1 GLucFrag2 hGaussia Luciferase fragment 2 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis C-terminal fragment of H. gaussia luciferase for PCA (detection of protein-protein interactions). See part J18928 for details. false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18924 1 ZipR34 R34 heterodimerizing leucine zipper 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis literature Engineered Leu zipper based on VBP B-ZIP domain that forms medium-weak parallel heterodimers with variants E34(X). This zipper corresponds to RR34(A) in Acharya et al and R34 in Bashor et al. Bashor et al. used the three different pairs to tune the affinity of their MAPK feedback device. Interaction with E34(X) variants: * E34(I): Kd = 6.1 nM = J18923 * E34(V): Kd = 41 nM * E34(N): Kd = 810 nM == References == * Acharya et al. (2002) A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. PMID: 12450375 * Bashor et al (2008) Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. PMID: 18339942 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_J18922 1 5xGS 10aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 10 amino acid linker. Translates to [GS]_5. Codon-optimize for E. coli, yeast, mammalian. false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli * experimental distance distributions are described in Neuweiler et al. 2006 papers. false Raik Gruenberg BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_J18945 1 BBa_J18945 ZipR34 ~ GLucFrag2 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z synthetic P13 expression cassette from Gruenberg et al. 2010 series of interaction reporter proteins. All proteins share the same architecture: * T7Start-domain1-5xGS-domain2-preSCsite-HisTag-T7Stop Only Domains1 and 2 vary and are taken from a list of protein interaction input and output (readout) parts. ===Expression=== Proteins were expressed in E. coli BL21 using T7 Polymerase and were purified by His-tag affinity. ===Reference=== * Gruenberg, Ferrar, van der Sloot, Serrano (2010): Building Blocks for Protein Interaction Devices false false _165_ 0 2175 165 It's complicated false Constructs were assembled according to R.F.C. 25. All parts were codon optimized for E. coli. false Raik Gruenberg component2066652 1 BBa_B0105 component2066659 1 BBa_J18919 component2066661 1 BBa_B0105 component2066647 1 BBa_J18912 component2066663 1 BBa_J18909 component2066667 1 BBa_J18913 component2066665 1 BBa_B0105 component2066653 1 BBa_J18922 component2066656 1 BBa_J18929 component2066650 1 BBa_J18924 component2066649 1 BBa_B0105 component2066655 1 BBa_B0105 component2066658 1 BBa_B0105 annotation2066647 1 BBa_J18912 range2066647 1 1 83 annotation2066658 1 BBa_B0105 range2066658 1 489 494 annotation2066663 1 BBa_J18909 range2066663 1 525 542 annotation2066649 1 BBa_B0105 range2066649 1 84 89 annotation2066655 1 BBa_B0105 range2066655 1 255 260 annotation2066650 1 BBa_J18924 range2066650 1 90 218 annotation2066665 1 BBa_B0105 range2066665 1 543 548 annotation2066653 1 BBa_J18922 range2066653 1 225 254 annotation2066661 1 BBa_B0105 range2066661 1 519 524 annotation2066659 1 BBa_J18919 range2066659 1 495 518 annotation2066656 1 BBa_J18929 range2066656 1 261 488 annotation2066652 1 BBa_B0105 range2066652 1 219 224 annotation2066667 1 BBa_J18913 range2066667 1 549 683 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18922_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_B0105_sequence 1 accggc BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18924_sequence 1 ctggaaatccgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcgtaaacgtgtgggccgttgccgtaacattgtgagcaaatacgaaacccgttatggcccgctg BBa_J18909_sequence 1 catcatcatcatcatcat BBa_J18912_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatg BBa_J18929_sequence 1 gaagcgattgtggatattccggaaattccgggctttaaagatctggaaccgatggaacagtttattgcgcaggtggatctgtgcgtggattgcaccaccggctgcctgaaaggcctggccaacgtgcagtgcagcgatctgctgaaaaaatggctgccgcagcgttgcgcgacctttgcgagcaaaattcagggccaggtggataaaattaaaggcgcgggtggcgat BBa_J18945_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatgaccggcctggaaatccgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcgtaaacgtgtgggccgttgccgtaacattgtgagcaaatacgaaacccgttatggcccgctgaccggcggtagcggcagcggtagcggtagcggcagcaccggcgaagcgattgtggatattccggaaattccgggctttaaagatctggaaccgatggaacagtttattgcgcaggtggatctgtgcgtggattgcaccaccggctgcctgaaaggcctggccaacgtgcagtgcagcgatctgctgaaaaaatggctgccgcagcgttgcgcgacctttgcgagcaaaattcagggccaggtggataaaattaaaggcgcgggtggcgataccggcctggaagtgctgtttcagggcccgaccggccatcatcatcatcatcataccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z