BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_J18946 1 BBa_J18946 ZipE34 ~ bla-frag1 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z synthetic P14 expression cassette from Gruenberg et al. 2010 series of interaction reporter proteins. All proteins share the same architecture: * T7Start-domain1-5xGS-domain2-preSCsite-HisTag-T7Stop Only Domains1 and 2 vary and are taken from a list of protein interaction input and output (readout) parts. ===Expression=== Proteins were expressed in E. coli BL21 using T7 Polymerase and were purified by His-tag affinity. ===Reference=== * Gruenberg, Ferrar, van der Sloot, Serrano (2010): Building Blocks for Protein Interaction Devices false false _165_ 0 2175 165 It's complicated false Constructs were assembled according to R.F.C. 25. All parts were codon optimized for E. coli. false Raik Gruenberg component2066683 1 BBa_B0105 component2066677 1 BBa_B0105 component2066686 1 BBa_B0105 component2066674 1 BBa_B0105 component2066681 1 BBa_I757011 component2066675 1 BBa_J18922 component2066690 1 BBa_B0105 component2066692 1 BBa_J18913 component2066672 1 BBa_J18923 component2066688 1 BBa_J18909 component2066669 1 BBa_J18912 component2066684 1 BBa_J18919 component2066671 1 BBa_B0105 annotation2066677 1 BBa_B0105 range2066677 1 255 260 annotation2066681 1 BBa_I757011 range2066681 1 261 803 annotation2066674 1 BBa_B0105 range2066674 1 219 224 annotation2066683 1 BBa_B0105 range2066683 1 804 809 annotation2066675 1 BBa_J18922 range2066675 1 225 254 annotation2066686 1 BBa_B0105 range2066686 1 834 839 annotation2066672 1 BBa_J18923 range2066672 1 90 218 annotation2066684 1 BBa_J18919 range2066684 1 810 833 annotation2066690 1 BBa_B0105 range2066690 1 858 863 annotation2066671 1 BBa_B0105 range2066671 1 84 89 annotation2066688 1 BBa_J18909 range2066688 1 840 857 annotation2066692 1 BBa_J18913 range2066692 1 864 998 annotation2066669 1 BBa_J18912 range2066669 1 1 83 BBa_J18912 1 T7start T7 promoter + RBS + START 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression vector Strong T7 promoter and RBS including start codon for protein expression in E. coli or in-vitro. Part is provided in RFC 25 assembly format. false false _165_ 0 2175 165 It's complicated false * sequence is taken from the commonly used pET3a expression vector * deleted XbaI site between prom. and RBS * T7 promoter sequence (1-19) equals the one in BBa_I712074 * Conservative choice of part boundaries and modifications -- the part's size could probably be reduced. false Raik Gruenberg annotation2065586 1 start range2065586 1 81 83 BBa_J18922 1 5xGS 10aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 10 amino acid linker. Translates to [GS]_5. Codon-optimize for E. coli, yeast, mammalian. false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli * experimental distance distributions are described in Neuweiler et al. 2006 papers. false Raik Gruenberg BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18923 1 ZipE34 E34(I) strong heterodimerizing leucine zipper 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis literature Engineered Leu zipper based on VBP B-ZIP domain that forms strong parallel heterodimers with R34. Interaction with R34: * Kd = 6.1 nM References ============ * Acharya et al. (2002) A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. PMID: 12450375 * Bashor et al (2008) Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. PMID: 18339942 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_I757011 1 BBa_I757011 bla_frag1(aa 26-199) Fusion Part 2007-10-23T11:00:00Z 2015-08-31T04:08:07Z synthetic DNA by GeneArt * first fragment of the split enzyme beta-lactamase * NgoMIV / AgeI protein fusion part * iGEM Team Freiburg 2007 false false _125_ 0 2006 9 It's complicated false between BioBrick 1.0 sites part is flanked 5' by NgoMIV and 3' AgeI(=PinAI) to facilitate in frame cloning for protein fusions false Freiburg iGEM 2007 team annotation1954441 1 NgoMIV range1954441 1 4 9 annotation1954442 1 AgeI range1954442 1 535 540 annotation1954942 1 bla_frag1 range1954942 1 10 534 BBa_J18922_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_J18946_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatgaccggcattaccattcgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtaccgaaattgcggaactggaaaaagaagtgggccgttgcgaaaacattgtgagcaaatacgaaacccgttatggcccgctgaccggcggtagcggcagcggtagcggtagcggcagcaccggcatggccggccacccggaaaccctggccaaagtgaaagatgcggaagatcagctgggtgcgcgtgtgggctatattgaactggatctgaacagcggcaaaattctggaatcttttcgtccggaagaacgttttccgatgatgagcacctttaaagtgctgctgtgcggtgcggttctgagccgtattgatgcgggccaggaacagctgggccgtcgtattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgggcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggtccgaaagaactgaccgcgtttctgcgtaacatgggcgatcatgtgacccgtctggatcgttgggaaccggaactgaacgaagcgattccgaacgatgaacgtgataccaccaccccggtggccatggcgaccaccctgcgtaaactgctgaccggcgaactgctgggcaccggttaaaccggcctggaagtgctgtttcagggcccgaccggccatcatcatcatcatcataccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_B0105_sequence 1 accggc BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_I757011_sequence 1 atggccggccacccggaaaccctggccaaagtgaaagatgcggaagatcagctgggtgcgcgtgtgggctatattgaactggatctgaacagcggcaaaattctggaatcttttcgtccggaagaacgttttccgatgatgagcacctttaaagtgctgctgtgcggtgcggttctgagccgtattgatgcgggccaggaacagctgggccgtcgtattcattatagccagaacgatctggtggaatatagcccggtgaccgaaaaacatctgaccgatggcatgaccgtgggcgaactgtgcagcgcggcgattaccatgagcgataacaccgcggcgaacctgctgctgaccaccattggcggtccgaaagaactgaccgcgtttctgcgtaacatgggcgatcatgtgacccgtctggatcgttgggaaccggaactgaacgaagcgattccgaacgatgaacgtgataccaccaccccggtggccatggcgaccaccctgcgtaaactgctgaccggcgaactgctgggcaccggttaa BBa_J18909_sequence 1 catcatcatcatcatcat BBa_J18912_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatg BBa_J18923_sequence 1 attaccattcgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtaccgaaattgcggaactggaaaaagaagtgggccgttgcgaaaacattgtgagcaaatacgaaacccgttatggcccgctg BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z