BBa_J18912 1 T7start T7 promoter + RBS + START 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression vector Strong T7 promoter and RBS including start codon for protein expression in E. coli or in-vitro. Part is provided in RFC 25 assembly format. false false _165_ 0 2175 165 It's complicated false * sequence is taken from the commonly used pET3a expression vector * deleted XbaI site between prom. and RBS * T7 promoter sequence (1-19) equals the one in BBa_I712074 * Conservative choice of part boundaries and modifications -- the part's size could probably be reduced. false Raik Gruenberg annotation2065586 1 start range2065586 1 81 83 BBa_J18924 1 ZipR34 R34 heterodimerizing leucine zipper 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis literature Engineered Leu zipper based on VBP B-ZIP domain that forms medium-weak parallel heterodimers with variants E34(X). This zipper corresponds to RR34(A) in Acharya et al and R34 in Bashor et al. Bashor et al. used the three different pairs to tune the affinity of their MAPK feedback device. Interaction with E34(X) variants: * E34(I): Kd = 6.1 nM = J18923 * E34(V): Kd = 41 nM * E34(N): Kd = 810 nM == References == * Acharya et al. (2002) A heterodimerizing leucine zipper coiled coil system for examining the specificity of a position interactions: amino acids I, V, L, N, A, and K. PMID: 12450375 * Bashor et al (2008) Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. PMID: 18339942 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18954 1 BBa_J18954 ZipR34 ~ mCitrine 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z synthetic P22 expression cassette from Gruenberg et al. 2010 series of interaction reporter proteins. All proteins share the same architecture: * T7Start-domain1-5xGS-domain2-preSCsite-HisTag-T7Stop Only Domains1 and 2 vary and are taken from a list of protein interaction input and output (readout) parts. ===Expression=== Proteins were expressed in E. coli BL21 using T7 Polymerase and were purified by His-tag affinity. ===Reference=== * Gruenberg, Ferrar, van der Sloot, Serrano (2010): Building Blocks for Protein Interaction Devices false false _165_ 0 2175 165 It's complicated false Constructs were assembled according to R.F.C. 25. All parts were codon optimized for E. coli. false Raik Gruenberg component2066986 1 BBa_J18922 component2066998 1 BBa_B0105 component2067000 1 BBa_J18913 component2066992 1 BBa_J18919 component2066983 1 BBa_J18924 component2066980 1 BBa_J18912 component2066988 1 BBa_B0105 component2066994 1 BBa_B0105 component2066985 1 BBa_B0105 component2066982 1 BBa_B0105 component2066991 1 BBa_B0105 component2066989 1 BBa_J18931 component2066996 1 BBa_J18909 annotation2066991 1 BBa_B0105 range2066991 1 975 980 annotation2066982 1 BBa_B0105 range2066982 1 84 89 annotation2066998 1 BBa_B0105 range2066998 1 1029 1034 annotation2066989 1 BBa_J18931 range2066989 1 261 974 annotation2066992 1 BBa_J18919 range2066992 1 981 1004 annotation2066983 1 BBa_J18924 range2066983 1 90 218 annotation2066980 1 BBa_J18912 range2066980 1 1 83 annotation2066988 1 BBa_B0105 range2066988 1 255 260 annotation2067000 1 BBa_J18913 range2067000 1 1035 1169 annotation2066985 1 BBa_B0105 range2066985 1 219 224 annotation2066994 1 BBa_B0105 range2066994 1 1005 1010 annotation2066996 1 BBa_J18909 range2066996 1 1011 1028 annotation2066986 1 BBa_J18922 range2066986 1 225 254 BBa_J18909 1 HisTag His tag (6xHis; E. coli - optimized) 2010-01-15T12:00:00Z 2015-08-31T04:08:35Z Synthetic DNA Hexahistidine affinity tag. Binds zinc, nickel, or cobalt affinity resins. =Notes= This part is identical to BBa_I757013 (which does not seem to be available though). =References= Wikipedia article: [http://en.wikipedia.org/wiki/Polyhistidine-tag] false false _165_ 0 2175 165 It's complicated false Simple repetition of the His codon most frequent in E. coli -- a more balanced codon-choice may be better. false Raik Gruenberg annotation2065463 1 PolyHis range2065463 1 1 18 BBa_J18922 1 5xGS 10aa [GS]x linker 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Highly flexible 10 amino acid linker. Translates to [GS]_5. Codon-optimize for E. coli, yeast, mammalian. false true _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli * experimental distance distributions are described in Neuweiler et al. 2006 papers. false Raik Gruenberg BBa_J18913 1 T7stop T7 terminator (incl. STOP) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z pET3a expression plasmid T7 terminator for protein expression in E. coli or in vitro. Part is provided in R.F.C. 25 assembly format. false false _165_ 0 2175 165 It's complicated false * taken from pET3a expression plasmid * added two STOP to 5' * conservative choice of part boundary, could probably be shortened false Raik Gruenberg annotation2065587 1 stop range2065587 1 1 6 BBa_J18931 1 mCitrine mCitrine 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis Yellow fluorescent protein mCitrine. ===See also=== * BBa_J18930 ===References=== * Griesbeck O, Baird GS, Campbell RE, Zacharias DA, Tsien RY. (2001) Reducing the environmental sensitivity of yellow fluorescent protein. Mechanism and applications. PMID: 11387331 false false _165_ 0 2175 165 It's complicated false * starts with consensus VSKGEEL * ends with consensus DELYK false Raik Gruenberg BBa_B0105 1 Scar 25 RFC 25 Scar Sequence 2009-10-14T11:00:00Z 2015-08-31T04:07:21Z BBF RFC 25 This is the scar produced by assembly using RFC 25. If you are assembling a composite part using RFC 25, you can insert this part and specify blunt assembly to get the desired sequence. false false _1_ 0 25 397 Not in stock false Simple DNA sequence false Randy Rettberg annotation2041621 1 Scar 25 range2041621 1 1 6 BBa_J18919 1 preSCsite preScission protease cleavage site (E. coli-optimized) 2010-01-26T12:00:00Z 2015-08-31T04:08:36Z gene synthesis cleavage site for PreScission??? protease. preScission protease cleavage site (PreScission??? protease is a genetically engineered form of human rhinovirus 3C protease with a GST fusion, allowing for facile cleavage and purification of GST-tagged proteins along with protease removal after recombinant protein cleavage. Enables low-temperature cleavage of fusion proteins containing the eight-residue recognition sequence.) cleavage site: * Leu-Glu-Val-Leu-Phe-Gln↓Gly-Pro References ============== Walker et al. (1994): Efficient and rapid affinity purification of proteins using recombinant fusion proteases. PMID: 7764949 false false _165_ 0 2175 165 It's complicated false * gene synthesis * codon optimized for E. coli false Raik Gruenberg BBa_J18922_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_B0105_sequence 1 accggc BBa_J18913_sequence 1 tagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18924_sequence 1 ctggaaatccgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcgtaaacgtgtgggccgttgccgtaacattgtgagcaaatacgaaacccgttatggcccgctg BBa_J18909_sequence 1 catcatcatcatcatcat BBa_J18912_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatg BBa_J18954_sequence 1 taatacgactcactatagggagaccacaacggtttccctctagcaataattttgtttaactttaagaaggagatatacatatgaccggcctggaaatccgtgcggcgtttctggaaaaagaaaacaccgcgctgcgtacccgtgcggcggaactgcgtaaacgtgtgggccgttgccgtaacattgtgagcaaatacgaaacccgttatggcccgctgaccggcggtagcggcagcggtagcggtagcggcagcaccggcgtgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggtggaactggatggtgatgtgaacggccataaatttagcgtgagcggcgaaggcgaaggtgatgcgacctatggcaaactgaccctgaaatttatttgcaccacgggtaaactgccggttccgtggccgaccctggtgaccacctttggctatggcctgatgtgctttgcgcgttatccggatcatatgaaacagcacgatttctttaaaagcgccatgccggaaggctatgtgcaggaacgcaccatcttttttaaagatgatggcaactataaaacccgtgcggaagtgaaatttgaaggcgataccctggtgaaccgtattgaactgaaaggcatcgatttcaaagaagatggcaacattctgggccataaactggaatataactacaacagccataacgtgtatatcatggcggataaacagaaaaacggcatcaaagtgaactttaaaatccgccacaacattgaagatggcagcgtgcagctggccgatcattatcagcagaacaccccgattggtgatggcccggtgctgctgccggataaccattatctgagctaccagagcaaactgagcaaagatccgaacgaaaaacgtgatcacatggtgctgctggaatttgtgaccgcagccggtattaccctgggcatggatgaactgtacaaaaccggcctggaagtgctgtttcagggcccgaccggccatcatcatcatcatcataccggctagtgactgctaacaaagcccgaaaggaagctgagttggctgctgccaccgctgagcaataactagcataaccccttggggcctctaaacgggtcttgaggggttttttgctgaaaggaggaactatatccggat BBa_J18931_sequence 1 gtgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggtggaactggatggtgatgtgaacggccataaatttagcgtgagcggcgaaggcgaaggtgatgcgacctatggcaaactgaccctgaaatttatttgcaccacgggtaaactgccggttccgtggccgaccctggtgaccacctttggctatggcctgatgtgctttgcgcgttatccggatcatatgaaacagcacgatttctttaaaagcgccatgccggaaggctatgtgcaggaacgcaccatcttttttaaagatgatggcaactataaaacccgtgcggaagtgaaatttgaaggcgataccctggtgaaccgtattgaactgaaaggcatcgatttcaaagaagatggcaacattctgggccataaactggaatataactacaacagccataacgtgtatatcatggcggataaacagaaaaacggcatcaaagtgaactttaaaatccgccacaacattgaagatggcagcgtgcagctggccgatcattatcagcagaacaccccgattggtgatggcccggtgctgctgccggataaccattatctgagctaccagagcaaactgagcaaagatccgaacgaaaaacgtgatcacatggtgctgctggaatttgtgaccgcagccggtattaccctgggcatggatgaactgtacaaa BBa_J18919_sequence 1 ctggaagtgctgtttcagggcccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z