BBa_J202000 1 BBa_J202000 PBAD mutant#1 2012-07-18T11:00:00Z 2015-08-31T04:08:36Z This mutant was created by random mutagenesis. Released HQ 2013 This is mutant of PBAD (BBa_I13453). false false _910_ 0 11164 9 In stock false In order to regulate transcription from PBAD, araC binds three different sites called araO2, araI1, and araI2. In the absence of L-arabinose, araC binds both araO2 and araI1 and bends DNA preventing transcription from PBAD. In the presence of L-arabinose, however, araC has a conformational change because of L-arabinose and binds araI1 and araI2, enabling transcription from PBAD. Like the wild-type (I13453), this part lacks araO2 site which is essential for araC repressor function, araC acts as an activator in the presence of L-arabinose. false Jiyeon Park annotation2177772 1 araC transcription start range2177772 1 112 112 annotation2177770 1 araI1 range2177770 1 40 56 annotation2177773 1 Mutation range2177773 1 57 57 annotation2177771 1 araI2 range2177771 1 61 77 BBa_J202000_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataggattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z