BBa_J202004 1 BBa_J202004 PBAD Mutant#5 2012-07-25T11:00:00Z 2015-08-31T04:08:37Z This mutant was created by site-directed mutagenesis. Released HQ 2013 This is PBAD (BBa_I13453) mutant. -71 relative to the araC transcriptional start site was changed from A to G. false false _910_ 0 11164 9 In stock false In order to regulate transcription from PBAD, araC binds three different sites called araO2, araI1, and araI2. In the absence of L-arabinose, araC binds both araO2 and araI1 and bends DNA preventing transcription from PBAD. In the presence of L-arabinose, however, araC has a conformational change because of L-arabinose and binds araI1 and araI2, enabling transcription from PBAD. Like the wild-type (I13453), this part does not have araO2 site which is essential for araC repressor function. Therefore, araC acts as an activator in the presence of L-arabinose. false Jiyeon Park annotation2178432 1 araI1 range2178432 1 40 56 annotation2178433 1 araI2 range2178433 1 61 77 annotation2178434 1 Transcription Start range2178434 1 112 112 annotation2178435 1 Mutation range2178435 1 41 41 BBa_J202004_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatggcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z