BBa_J202031 1 BBa_J202031 Ptet Mutant#1 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. This is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 2 was changed from G to A. false false _910_ 0 11164 9 It's complicated false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178814 1 Mutation range2178814 1 8 8 annotation2178815 1 Mutation range2178815 1 12 12 annotation2178817 1 Mutation range2178817 1 37 37 annotation2178813 1 O2 range2178813 1 26 44 annotation2178816 1 Mutation range2178816 1 33 33 annotation2178812 1 O2 range2178812 1 1 19 BBa_J202031_sequence 1 tccctattagtaatagagattgacatccctattagtaatagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z