BBa_J202032 1 BBa_J202032 Ptet Mutant#2 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. his is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 3 was changed from A to C. false false _910_ 0 11164 9 It's complicated false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178819 1 O2 range2178819 1 26 44 annotation2178818 1 O2 range2178818 1 1 19 annotation2178821 1 Mutation range2178821 1 13 13 annotation2178822 1 Mutation range2178822 1 32 32 annotation2178823 1 Mutation range2178823 1 38 38 annotation2178820 1 Mutation range2178820 1 7 7 BBa_J202032_sequence 1 tccctagcagtgctagagattgacatccctagcagtgctagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z