BBa_J202033 1 BBa_J202033 Ptet Mutant#3 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. This is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 3 was changed from A to G. false false _910_ 0 11164 9 In stock false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178826 1 Mutation range2178826 1 7 7 annotation2178827 1 Mutation range2178827 1 13 13 annotation2178828 1 Mutation range2178828 1 32 32 annotation2178829 1 Mutation range2178829 1 38 38 annotation2178824 1 O2 range2178824 1 1 19 annotation2178825 1 O2 range2178825 1 26 44 BBa_J202033_sequence 1 tccctaccagtggtagagattgacatccctaccagtggtagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z