BBa_J202034 1 BBa_J202034 Ptet Mutant#4 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. This is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 4 was changed from T to A. false false _910_ 0 11164 9 It's complicated false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178833 1 Mutation range2178833 1 39 39 annotation2178831 1 Mutation range2178831 1 14 14 annotation2178835 1 O2 range2178835 1 26 44 annotation2178834 1 O2 range2178834 1 1 19 annotation2178832 1 Mutation range2178832 1 31 31 annotation2178830 1 Mutation range2178830 1 6 6 BBa_J202034_sequence 1 tccctttcagtgaaagagattgacatccctttcagtgaaagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z