BBa_J202035 1 BBa_J202035 Ptet Mutant#5 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. This is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 4 was changed from T to C. false false _910_ 0 11164 9 In stock false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178837 1 Mutation range2178837 1 14 14 annotation2178839 1 Mutation range2178839 1 39 39 annotation2178841 1 O2 range2178841 1 26 44 annotation2178836 1 Mutation range2178836 1 6 6 annotation2178840 1 O2 range2178840 1 1 19 annotation2178838 1 Mutation range2178838 1 31 31 BBa_J202035_sequence 1 tccctgtcagtgacagagattgacatccctgtcagtgacagagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z