BBa_J202037 1 BBa_J202037 Ptet Mutant#7 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. This is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 5 was changed from A to T. false false _910_ 0 11164 9 Not in stock false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178849 1 Mutation range2178849 1 15 15 annotation2178852 1 O2 range2178852 1 1 19 annotation2178848 1 Mutation range2178848 1 5 5 annotation2178853 1 O2 range2178853 1 26 44 annotation2178850 1 Mutation range2178850 1 30 30 annotation2178851 1 Mutation range2178851 1 40 40 BBa_J202037_sequence 1 tcccaatcagtgattgagattgacatcccaatcagtgattgagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z