BBa_J202038 1 BBa_J202038 Ptet Mutant#8 2012-07-26T11:00:00Z 2015-08-31T04:08:37Z This mutant was generated by synthetic oligonucleotides. This is Ptet (BBa_R0040) mutant. Based on Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880, position 6 was changed from G to C. false false _910_ 0 11164 9 It's complicated false Mutants were designed based on in vivo assay results (Sizemore et al. 1990. Quantitative analysis of Tn10 Tet repressor binding to a complete set of tet operator mutants. Nucleic Acids Research. 18. 2875-2880). false Jiyeon Park annotation2178854 1 Mutation range2178854 1 4 4 annotation2178855 1 Mutation range2178855 1 16 16 annotation2178857 1 Mutation range2178857 1 41 41 annotation2178856 1 Mutation range2178856 1 29 29 annotation2178859 1 O2 range2178859 1 26 44 annotation2178858 1 O2 range2178858 1 1 19 BBa_J202038_sequence 1 tccgtatcagtgatacagattgacatccgtatcagtgatacagatactgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z