BBa_J22000 1 BBa_J22000 DnaA binding sequence - Px 2006-07-26T11:00:00Z 2015-08-31T04:08:38Z where the sequence was taken from? Genebank or a paper site the paper description of DnaA, binding affinity , no. of binding sites etc. true false _70_ 0 439 70 Discontinued false Any mutations? false Sugat Dabholkar BBa_J22000_sequence 1 tcgagtctcgtttcccgctccaaattcttctctcaataaaatatccacagcgacgcgatgcgttattgctggtttttgttgtctctgacaaactcttgtaaacagagttatccacagcctcaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z