BBa_J22052 1 BBa_J22052 Pcya 2006-09-03T11:00:00Z 2015-08-31T04:08:38Z Ref: J. Biol. Chem., Vol. 260, Issue 5, 3063-3070, 03, 1985 Transcription of the Escherichia coli adenylate cyclase gene is negatively regulated by cAMP-cAMP receptor protein H Aiba [bases -53 to 12] This is a adenylate cyclase promoter that has been reported to oscillate in cell cycle dependant manner. false false _70_44_ 0 439 70 Not in stock false No design problems false Sugat Dabholkar BBa_J22052_sequence 1 gtatgtagcgcatctttctttacggtcaatcagcaaggtgttaaattgatcacgttttagaccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z