BBa_J23007 1 BBa_J23007 [key3b] riboregulator for lock3 variants 2006-07-07T11:00:00Z 2015-08-31T04:08:38Z The part is dervied from J01122 J23007 is a derivative of J01129 with a 3 base pair modification. The purpose of J01129 is to "unlock" the "locked" sequence contained in J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. With the introduction of J01129 (in trans) the hairpin in J01122 can be destroyed. When J01129 is transcribed the RNA secondary structure is that of a hair pin with linear (uninhibited) sequence downstream of the hairpin. This linear sequence preferentially anneals to the stem of the hairpin opposite the RBS on J01122 which destroys the hairpin and frees the RBS allowing translation of RFP to occur. The region on J01129 that binds to the hairpin of J01122 anneals perfectly except for 3 base pairs which are mismatched. J23007 is exactly J01129 except these three base pairs have been corrected for perfect base pairing. false false _52_ 0 936 52 In stock false No design considerations true bryan hernandez BBa_J23007_sequence 1 acccaaaagcaagaggtgattctagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z