BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23007 1 BBa_J23007 [key3b] riboregulator for lock3 variants 2006-07-07T11:00:00Z 2015-08-31T04:08:38Z The part is dervied from J01122 J23007 is a derivative of J01129 with a 3 base pair modification. The purpose of J01129 is to "unlock" the "locked" sequence contained in J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. With the introduction of J01129 (in trans) the hairpin in J01122 can be destroyed. When J01129 is transcribed the RNA secondary structure is that of a hair pin with linear (uninhibited) sequence downstream of the hairpin. This linear sequence preferentially anneals to the stem of the hairpin opposite the RBS on J01122 which destroys the hairpin and frees the RBS allowing translation of RFP to occur. The region on J01129 that binds to the hairpin of J01122 anneals perfectly except for 3 base pairs which are mismatched. J23007 is exactly J01129 except these three base pairs have been corrected for perfect base pairing. false false _52_ 0 936 52 In stock false No design considerations true bryan hernandez BBa_J23020 1 BBa_J23020 [key3b][TT] 2006-08-02T11:00:00Z 2015-08-31T04:08:39Z J23007.b0015 Part to test the effect of explicit terminator on key3b. Part in pJ23006, so there is a Ptet upstream of XbaI site. false false _52_ 0 483 95 Not in stock false N/A false John Anderson component1893429 1 BBa_B0010 component1893428 1 BBa_J23007 component1893431 1 BBa_B0012 annotation1893428 1 BBa_J23007 range1893428 1 1 27 annotation1893429 1 BBa_B0010 range1893429 1 36 115 annotation1893431 1 BBa_B0012 range1893431 1 124 164 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23020_sequence 1 acccaaaagcaagaggtgattctagtttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23007_sequence 1 acccaaaagcaagaggtgattctagtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z