BBa_J23027 1 BBa_J23027 [TraMf][TT] 2006-07-24T11:00:00Z 2015-08-31T04:08:39Z [TraMf][TT] Digest pSB1A2-J23011 (EcoRI/SpeI, Neb2, Small ) Paste into pSB1AKG0-B0015 (EcoRI/XbaI, Neb2, Large 2062) Product is pSB1A2-J23027. [TraMf][TT] false false _52_ 0 483 95 Not in stock false n/a false John Anderson component1891573 1 BBa_J23011 component1891574 1 BBa_B0010 component1891576 1 BBa_B0012 annotation1891574 1 BBa_B0010 range1891574 1 393 472 annotation1891573 1 BBa_J23011 range1891573 1 1 384 annotation1891576 1 BBa_B0012 range1891576 1 481 521 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_J23011 1 BBa_J23011 [TraMf] 2006-07-10T11:00:00Z 2015-08-31T04:08:38Z wt.F plasmid POX38 [TraMf] false false _52_ 0 931 52 Not in stock false oligos. false Kaitlin Davis BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23027_sequence 1 atggctaaggtgaacctgtatatcagcaatgatgcctatgaaaaaataaatgcgattattgagaagcgtcgacaggaaggggcaagggaaaaagatgtcagtttttcagcaacagcttcaatgcttcttgaactggggcttcgtgtacatgaggctcagatggagcgtaaagagtctgcatttaatcagactgagtttaataaattgcttcttgaatgcgttgtaaaaacacaatcatcagtagcgaaaattttgggtattgagtctctcagtcctcatgtctccggaaattcaaagtttgaatatgccaatatggttgaagatatcagggagaaggtatcatctgagatggaacgattttttccaaaaaatgatgatgaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23011_sequence 1 atggctaaggtgaacctgtatatcagcaatgatgcctatgaaaaaataaatgcgattattgagaagcgtcgacaggaaggggcaagggaaaaagatgtcagtttttcagcaacagcttcaatgcttcttgaactggggcttcgtgtacatgaggctcagatggagcgtaaagagtctgcatttaatcagactgagtttaataaattgcttcttgaatgcgttgtaaaaacacaatcatcagtagcgaaaattttgggtattgagtctctcagtcctcatgtctccggaaattcaaagtttgaatatgccaatatggttgaagatatcagggagaaggtatcatctgagatggaacgattttttccaaaaaatgatgatgaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z