BBa_J23037 1 BBa_J23037 [Ser2AGGA] 2006-08-03T11:00:00Z 2015-08-31T04:08:39Z Insertion of Ser2AGGA from pAC-Ser2AGGA into the NsiI and MfeI sites of ???? Four base codon (AGGA) suppressor. Inserts a single serine residue in response to the sequence AGGA. false false _52_ 0 483 95 Not in stock false N/A false John Anderson annotation1893447 1 Ser2AGGA range1893447 1 8 98 BBa_J23037_sequence 1 tcaattcggagagatgccggagcggctgaacggaccggtcttcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z