BBa_J23041 1 BBa_J23041 [PK2][key3c] 2006-08-03T11:00:00Z 2015-08-31T04:08:39Z PK2.J23008 [PK2][key3c] false false _52_ 0 483 95 Not in stock false N/A false John Anderson component1895314 1 BBa_J23008 component1895313 1 BBa_J01007 annotation1895313 1 BBa_J01007 range1895313 1 1 60 annotation1895314 1 BBa_J23008 range1895314 1 69 162 BBa_J23008 1 BBa_J23008 [key3c] riboregulator for lock3 variants 2006-07-09T11:00:00Z 2015-08-31T04:08:38Z J23007 This part has the same homology region to J01122 as J23007 except that unlike J23007, J23008 does not contain the hairpin that was derived from J01129. J23008 anneals linearly to the stem of the hairpin in J01122 with perfect base pairing and destroys the hairpin in the process and reveals the RBS on J01122. When J01122 is transcribed the RNA secondary structure is such that the RBS hairpins with sequence upstream preventing the ribosome from binding and translation from occuring thereby locking up RFP further down stream. When J23008 is introduced into the cell in trans, we suspect that it will unlock the RBS for RFP as described above allowing translation to occur. false false _52_ 0 931 52 In stock false No design considerations true Kaitlin Davis BBa_J01007 1 PK2 Key Promoter absorbs 2 2005-11-04T12:00:00Z 2015-08-31T04:08:12Z Promoter for transcribing keys to act on locks based on Isaacs, Collins, et. al: "Engineered riboregulators enable post-transcriptional control of gene expression" PK2 absorbs three nucleotides from mixed site ("TACTAGAG"), so that the key has a 5 nucleotide spacer region (i.e. "TAGAG") between the transcription start site and the first nucleotide of the key. We are still looking into what the optimal size for the spacer region is. See also PK3 (BBa_J01006), and Key1 (BBa_J01008), Key2 (BBa_J01009), Lock1 (BBa_J01010), and Lock2 (BBa_J01011). true false _13_ 0 395 13 Discontinued false false Golden Bear BBa_J23041_sequence 1 tcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccactactagagacccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J23008_sequence 1 acccaaaagcaagaggtgattctagttggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt BBa_J01007_sequence 1 tcagaaaattattttaaatttcctcttgtcaggccggaataactccctataatgcgccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z