BBa_J23102 1 BBa_J23102 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters Released HQ 2013 replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23063 1 BBa_J23063 [P_con (strong)][Ser2AGGA] 2006-08-09T11:00:00Z 2015-08-31T04:08:39Z J23102.J23037 Four base suppressor Ser2AGGA under a constitutive promoter false false _52_ 0 483 95 Not in stock false N/A false John Anderson component1895130 1 BBa_J23102 component1895132 1 BBa_J23037 annotation1895132 1 BBa_J23037 range1895132 1 44 148 annotation1895130 1 BBa_J23102 range1895130 1 1 35 BBa_J23037 1 BBa_J23037 [Ser2AGGA] 2006-08-03T11:00:00Z 2015-08-31T04:08:39Z Insertion of Ser2AGGA from pAC-Ser2AGGA into the NsiI and MfeI sites of ???? Four base codon (AGGA) suppressor. Inserts a single serine residue in response to the sequence AGGA. false false _52_ 0 483 95 Not in stock false N/A false John Anderson annotation1893447 1 Ser2AGGA range1893447 1 8 98 BBa_J23063_sequence 1 ttgacagctagctcagtcctaggtactgtgctagctactagagtcaattcggagagatgccggagcggctgaacggaccggtcttcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatg BBa_J23037_sequence 1 tcaattcggagagatgccggagcggctgaacggaccggtcttcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatg BBa_J23102_sequence 1 ttgacagctagctcagtcctaggtactgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z