BBa_J23064 1 BBa_J23064 [P_con A2 (medium)][Ser2AGGA] 2006-08-09T11:00:00Z 2015-08-31T04:08:39Z J23104.J23037 Medium-strength constitutive promoter contolling four-base suppressor Ser2AGGA. Sequencing reads iG088 and iG089, was previously named iG061 and iG057, but those numbers were already taken. false false _52_ 0 483 95 Not in stock false N/A false John Anderson component1895135 1 BBa_J23104 component1895137 1 BBa_J23037 annotation1895135 1 BBa_J23104 range1895135 1 1 35 annotation1895137 1 BBa_J23037 range1895137 1 44 148 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_J23037 1 BBa_J23037 [Ser2AGGA] 2006-08-03T11:00:00Z 2015-08-31T04:08:39Z Insertion of Ser2AGGA from pAC-Ser2AGGA into the NsiI and MfeI sites of ???? Four base codon (AGGA) suppressor. Inserts a single serine residue in response to the sequence AGGA. false false _52_ 0 483 95 Not in stock false N/A false John Anderson annotation1893447 1 Ser2AGGA range1893447 1 8 98 BBa_J23037_sequence 1 tcaattcggagagatgccggagcggctgaacggaccggtcttcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatg BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_J23064_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagtcaattcggagagatgccggagcggctgaacggaccggtcttcctaaaccggagtaggggcaactctaccgggggttcaaatccccctctctccgccactgcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z