BBa_J23014 1 [trbCf] trbCf open reading frame basic part 2006-07-23T11:00:00Z 2015-08-31T04:08:39Z PCR JL14/JL15 on Olambda (679bp, EcoRI/SpeI, Neb2) Paste into pSB1A2-I13521 (EcoRI/SpeI, Neb2, Large 2062) trbCf complement false false _52_ 0 363 52 Not in stock false Actually, oligos JL14 and JL15 did not work, so we had to create 20mers JL16 and JL17 in order to get the trbCf gene and will work with that. false Will Bosworth BBa_J23075 1 BBa_J23075 [RA2 Promoter][RBS][trbCf][TT] 2006-08-24T11:00:00Z 2015-08-31T04:08:39Z [RA2 Promoter][RBS][trbCf][TT] Digest PCR product of pSB1A2-J23038 with G00101 and ca641R (BSAI/SpeI, Neb2, ~1600 ) Paste into pSB1AK3-J23028 (XbaI/BsaI, Neb2, Large 5229) Product is pSB1AK3-J23075. [RA2 Promoter][RBS][trbCf][TT] false false _52_ 0 933 52 Not in stock false pSB1A2-J23038 has a really short sequence between XbaI and SpeI so okay to PCR because miniprep was messy. false Samantha Liang component1900917 1 BBa_B0012 component1900914 1 BBa_J23014 component1900911 1 BBa_J23104 component1900915 1 BBa_B0010 component1900913 1 BBa_B0034 annotation1900914 1 BBa_J23014 range1900914 1 62 703 annotation1900915 1 BBa_B0010 range1900915 1 712 791 annotation1900917 1 BBa_B0012 range1900917 1 800 840 annotation1900911 1 BBa_J23104 range1900911 1 1 35 annotation1900913 1 BBa_B0034 range1900913 1 44 55 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23014_sequence 1 atgaagctgagtatgaaatctctggcagcactgctgatgatgctgaacggggcggttatggcgtcagaaaacgtgaacactcctgaaaaccgccagttcctgaagcagcaggaaaatttaagcagacaactgcgtgaaaaacctgaccatcagctgaaagcctgggcggagaaacaggtgctggaaaacccccttcagcgttcagataaccatttcctggatgagctggttcgtaaacagcaggcttcgcaggacgggaaaccccggcagggtgctctgtattttgtgtcgttttccattcccgaagaggggctgaaacgaatgctgggcgaaacccggcacttcggtattccggccacactgcggggcatggtgaacaatgacctgaagaccaccgctgaagctgtgttgtccctggtgaaagacggcgcgactgatggtgttcagatcgacccgacgctgttttcacagtacggcattcgcactgtaccggcactggtggtgttctgcagtcagggatacgacatcatccggggaaacctgcgggtcggccaggcgctggagaaagtggccgccacgggtgactgccggcaggtggctcatgatttactggcagggaaaggagattccgggaaatgaaac BBa_B0034_sequence 1 aaagaggagaaa BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc BBa_J23075_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaatactagatgaagctgagtatgaaatctctggcagcactgctgatgatgctgaacggggcggttatggcgtcagaaaacgtgaacactcctgaaaaccgccagttcctgaagcagcaggaaaatttaagcagacaactgcgtgaaaaacctgaccatcagctgaaagcctgggcggagaaacaggtgctggaaaacccccttcagcgttcagataaccatttcctggatgagctggttcgtaaacagcaggcttcgcaggacgggaaaccccggcagggtgctctgtattttgtgtcgttttccattcccgaagaggggctgaaacgaatgctgggcgaaacccggcacttcggtattccggccacactgcggggcatggtgaacaatgacctgaagaccaccgctgaagctgtgttgtccctggtgaaagacggcgcgactgatggtgttcagatcgacccgacgctgttttcacagtacggcattcgcactgtaccggcactggtggtgttctgcagtcagggatacgacatcatccggggaaacctgcgggtcggccaggcgctggagaaagtggccgccacgggtgactgccggcaggtggctcatgatttactggcagggaaaggagattccgggaaatgaaactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z