BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_J23082 1 BBa_J23082 [Ser2 tRNA key(-33)][b0015] 2006-11-14T12:00:00Z 2015-08-31T04:08:40Z j23094 and b0015 j23094 with b0015 added to the 5' end. false false _52_ 0 936 52 Not in stock false the presence of terminators on the 5' end of ribopregulator keys have consistently shown to produce a 2 fold improvement in activation potential. false bryan hernandez component1910462 1 BBa_J23094 component1910463 1 BBa_B0010 component1910465 1 BBa_B0012 annotation1910465 1 BBa_B0012 range1910465 1 227 267 annotation1910463 1 BBa_B0010 range1910463 1 139 218 annotation1910462 1 BBa_J23094 range1910462 1 1 130 BBa_J23094 1 BBa_J23094 Ser2 tRNA key(-33) 2006-11-14T12:00:00Z 2015-08-31T04:08:40Z ser2 tRNA this is a ser2 derived tRNA key with an addressive sequence that anneals to the 5' most part of the lock while still completely covering the rbs'. the 3' most base on the lock will be called base (0). so key(0)'s 3'-most binding occurs at base (0) on the lock. key(n)'s 3' most binding occurs at base n. false false _52_ 0 936 52 Not in stock false this is a variant of keys designed to test the key's activation potential with respect to its specific annealling location on the lock while still completely duplexing with the rbs' false bryan hernandez BBa_J23094_sequence 1 ggagagatgccggagcggctgaacggaccgggatccataaaaaagaggtgattctagttcggtctacacaaaaaagcttcccggagtaggggcaactctaccgggggttcaaatccccctctctccgcca BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23082_sequence 1 ggagagatgccggagcggctgaacggaccgggatccataaaaaagaggtgattctagttcggtctacacaaaaaagcttcccggagtaggggcaactctaccgggggttcaaatccccctctctccgccatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z