BBa_J23088 1 BBa_J23088 [lock3][trbC] 2006-10-05T11:00:00Z 2015-08-31T04:08:40Z J23078 J23028 [lock3][trbC]. Part is in pSB1AG0 (there is a gentamicin cassette between EcoRI and XbaI) false false _52_ 0 483 95 Not in stock false N/A false John Anderson component1902521 1 BBa_B0010 component1902520 1 BBa_J23014 component1902523 1 BBa_B0012 component1902519 1 BBa_J23078 annotation1902520 1 BBa_J23014 range1902520 1 59 700 annotation1902519 1 BBa_J23078 range1902519 1 1 52 annotation1902523 1 BBa_B0012 range1902523 1 797 837 annotation1902521 1 BBa_B0010 range1902521 1 709 788 BBa_J23078 1 BBa_J23078 [lock3i] 2006-09-12T11:00:00Z 2015-08-31T04:08:39Z <tt> PCR ca1028F/G00101 on pJ23006-J23032 . . . (162 bp, XbaI/PstI)<br> Sub into pSB1A2-I13521 . . . . . . . . . . (XbaI/PstI)<br> Product is pSB1A2-J23078<br> </tt> lock3d derivative with a 5' extension. This is the basic part, J23077 is the RFP reporter. false true _52_ 0 483 95 It's complicated false N/A false John Anderson BBa_J23014 1 [trbCf] trbCf open reading frame basic part 2006-07-23T11:00:00Z 2015-08-31T04:08:39Z PCR JL14/JL15 on Olambda (679bp, EcoRI/SpeI, Neb2) Paste into pSB1A2-I13521 (EcoRI/SpeI, Neb2, Large 2062) trbCf complement false false _52_ 0 363 52 Not in stock false Actually, oligos JL14 and JL15 did not work, so we had to create 20mers JL16 and JL17 in order to get the trbCf gene and will work with that. false Will Bosworth BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23014_sequence 1 atgaagctgagtatgaaatctctggcagcactgctgatgatgctgaacggggcggttatggcgtcagaaaacgtgaacactcctgaaaaccgccagttcctgaagcagcaggaaaatttaagcagacaactgcgtgaaaaacctgaccatcagctgaaagcctgggcggagaaacaggtgctggaaaacccccttcagcgttcagataaccatttcctggatgagctggttcgtaaacagcaggcttcgcaggacgggaaaccccggcagggtgctctgtattttgtgtcgttttccattcccgaagaggggctgaaacgaatgctgggcgaaacccggcacttcggtattccggccacactgcggggcatggtgaacaatgacctgaagaccaccgctgaagctgtgttgtccctggtgaaagacggcgcgactgatggtgttcagatcgacccgacgctgttttcacagtacggcattcgcactgtaccggcactggtggtgttctgcagtcagggatacgacatcatccggggaaacctgcgggtcggccaggcgctggagaaagtggccgccacgggtgactgccggcaggtggctcatgatttactggcagggaaaggagattccgggaaatgaaac BBa_J23078_sequence 1 tgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggaga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23088_sequence 1 tgtagaccgaactagaatcacctcttgcttttgggtaagacagaagaggagatactagatgaagctgagtatgaaatctctggcagcactgctgatgatgctgaacggggcggttatggcgtcagaaaacgtgaacactcctgaaaaccgccagttcctgaagcagcaggaaaatttaagcagacaactgcgtgaaaaacctgaccatcagctgaaagcctgggcggagaaacaggtgctggaaaacccccttcagcgttcagataaccatttcctggatgagctggttcgtaaacagcaggcttcgcaggacgggaaaccccggcagggtgctctgtattttgtgtcgttttccattcccgaagaggggctgaaacgaatgctgggcgaaacccggcacttcggtattccggccacactgcggggcatggtgaacaatgacctgaagaccaccgctgaagctgtgttgtccctggtgaaagacggcgcgactgatggtgttcagatcgacccgacgctgttttcacagtacggcattcgcactgtaccggcactggtggtgttctgcagtcagggatacgacatcatccggggaaacctgcgggtcggccaggcgctggagaaagtggccgccacgggtgactgccggcaggtggctcatgatttactggcagggaaaggagattccgggaaatgaaactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z